Finding Repeated DNA Sequences

The problem asks us to identify all 10-letter-long sequences that appear more than once in a given DNA sequence. DNA sequences are represented as strings composed of the characters 'A', 'C', 'G', and 'T'. This is a common bioinformatics task, useful for tasks like gene annotation and identifying repetitive elements within genomes.

Problem Description

Given a string s representing a DNA sequence, find all 10-letter-long substrings that occur more than once in s.

Key Requirements:

A substring is a contiguous sequence of characters within a string.
The length of the substrings we are looking for is exactly 10.
We need to return a list of all such 10-letter substrings that appear at least twice.
The order of the repeated sequences in the output does not matter.
Each repeated sequence should appear only once in the output list, even if it appears more than twice in the input string.

Expected Behavior:

The function should iterate through the input DNA string, consider all possible 10-letter substrings, and keep track of their occurrences. If a substring is encountered for the second time (or more), it should be added to the result list.

Edge Cases to Consider:

Short Input String: If the input string s has a length less than 10, there can be no 10-letter substrings, so the output should be an empty list.
No Repeated Sequences: If all 10-letter substrings are unique, the output should be an empty list.
All Characters Identical: A string like "AAAAAAAAAAAA..." might have many overlapping repeated sequences.

Examples

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]
Explanation: The 10-letter substrings "AAAAACCCCC" and "CCCCCAAAAA" both appear twice.

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
Explanation: The 10-letter substring "AAAAAAAAAA" appears 3 times.

Example 3:

Input: s = "AGCTAGCTAGCT"
Output: []
Explanation: All 10-letter substrings are unique. The only 10-letter substrings are "AGCTAGCTAG" and "GCTAGCTAGC".

Constraints

1 <= s.length <= 10^5
s consists only of the characters 'A', 'C', 'G', and 'T'.
The solution should aim for an efficient time complexity.

Notes

Consider how you can efficiently keep track of the substrings you've already seen.
Think about data structures that can help with frequency counting or set membership checks.
The problem involves overlapping substrings, so simply splitting the string into non-overlapping chunks won't work. You'll need to consider sliding windows or similar approaches.

Finding Repeated DNA Sequences

Problem Description

Given a string s representing a DNA sequence, find all 10-letter-long substrings that occur more than once in s.

Key Requirements:

A substring is a contiguous sequence of characters within a string.

The length of the substrings we are looking for is exactly 10.

We need to return a list of all such 10-letter substrings that appear at least twice.

The order of the repeated sequences in the output does not matter.

Each repeated sequence should appear only once in the output list, even if it appears more than twice in the input string.

Expected Behavior:

Edge Cases to Consider:

Short Input String: If the input string s has a length less than 10, there can be no 10-letter substrings, so the output should be an empty list.

No Repeated Sequences: If all 10-letter substrings are unique, the output should be an empty list.

All Characters Identical: A string like "AAAAAAAAAAAA..." might have many overlapping repeated sequences.

Examples

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC", "CCCCCAAAAA"] Explanation: The 10-letter substrings "AAAAACCCCC" and "CCCCCAAAAA" both appear twice.

Example 2:

Input: s = "AAAAAAAAAAAAA" Output: ["AAAAAAAAAA"] Explanation: The 10-letter substring "AAAAAAAAAA" appears 3 times.

Example 3:

Input: s = "AGCTAGCTAGCT" Output: [] Explanation: All 10-letter substrings are unique. The only 10-letter substrings are "AGCTAGCTAG" and "GCTAGCTAGC".

Notes

Consider how you can efficiently keep track of the substrings you've already seen.

Think about data structures that can help with frequency counting or set membership checks.

The problem involves overlapping substrings, so simply splitting the string into non-overlapping chunks won't work. You'll need to consider sliding windows or similar approaches.